 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circRNA_101319 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Rheumatoid Arthritis (RA) | ICD-10 | #N/A (M06.9) |
| DBLink | Link to database | PMID | https://academicjournals.org/journal/AJB/article-full-text/9E8BCC658072 |
| Experimental Method | |||
| Sample Type | Peripheral blood lymphocytes | Comparison | Three RA patients (1 man and 2 women; age range of 50 to 62 years). As controls, three healthy volunteers were recruited (1 man and 2 women; age range of 49 to 63 years). |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward CAGCAACAGTGGCAATGAGA ReverseTTATAGGGAGCTTCCAGCATG | Statistics | Fold Change : Downregulated pvalue : <0.05 |
| Citation | |||
| https://academicjournals.org/journal/AJB/article-full-text/9E8BCC658072 | |||